Brand  (β version)

  The number of atoms exceeds 100,000.
  So, it can not be displayed here.

Select unit:

Select chain:   Sequence  

Data format:   

Color scheme of protein:

Ligands
Code Name Style Show Link
Non-standard Residues
Code Name Show
DN Unknown 2'-deoxynucleotide
Glycosylation
Code Name Emphasize
Modification
Code Name Show
Code : 6TNF   PDBj   RCSB PDB   PDBe
Header : DNA BINDING PROTEIN
Title : Structure of monoubiquitinated FANCD2 in complex with FANCI and DNA
Release Data : 2020-02-19
Compound :
mol_id molecule chains
1 FANCD2 A
mol_id molecule chains
2 Fanconi anemia complementation group I B
mol_id molecule chains
3 Polyubiquitin-C C
mol_id molecule chains
4 DNA (33-MER) D,E
other_details: An idealized dsDNA of 33 bp of arbitrary sequence was placed and refined into the EM density but the following DNA sequences were used in the sample preparation by annealing oligonucleotides X1, X2, X3, X4, X5, X6: X1: GCGCACCAAGAGATACGCGGTCGAATGCCGAGTAGCCATCAGCG X2: ACCATGCAGCTACTCGGCATTCGACCGCGTATCTGGCGACTACG X3: TATCTCTTGGTGCGC X4: CGCTGATGGCTACTC X5: CGTAGTCGCCAGATA X6: GAGTAGCTGCATGGT
Source :
mol_id organism_scientific organism_common expression_system
1 Gallus gallus  (taxid:9031) Chicken Spodoptera frugiperda  (taxid:7108)
gene: FANCD2
expression_system_common: Fall armyworm
mol_id organism_scientific organism_common expression_system
2 Gallus gallus  (taxid:9031) Chicken Spodoptera frugiperda  (taxid:7108)
gene: FANCI
expression_system_common: Fall armyworm
mol_id organism_scientific organism_common expression_system
3 Homo sapiens  (taxid:9606) Human Escherichia coli  (taxid:562)
gene: UBC
mol_id organism_scientific
4 Synthetic construct  (taxid:32630)
synthetic: yes
Authors : Alcon, P., Shakeel, S., Passmore, L.A.
Keywords : Fanconi anaemia, ubiquitin, DNA repair, DNA damage, inter-strand crosslink, DNA BINDING PROTEIN
Exp. method : ELECTRON MICROSCOPY ( 3.8 Å )
Citation :

FANCD2-FANCI is a clamp stabilized on DNA by monoubiquitination of FANCD2 during DNA repair.

Alcon, P.,Shakeel, S.,Chen, Z.A.  et al.
(2020)  Nat.Struct.Mol.Biol.  27 : 240 - 248

PubMed: 32066963
DOI: 10.1038/s41594-020-0380-1

Chain : A
UniProt : F1NP22
Reaction : -
Chain : B
UniProt : B0I564 (FANCI_CHICK)
Reaction : -
Chain : C
UniProt : P0CG48 (UBC_HUMAN)
Reaction : -