Brand  (β version)

  The number of atoms exceeds 100,000.
  So, it can not be displayed here.

Select unit:

Color scheme of protein:

Code Name Style Show Link

Select chain:  

Data format:   

Non-standard Residues
Code Name Show
Glycosylation
Code Name Emphasize
Modification
Code Name Show
Code : 1QWA   PDBj   RCSB PDB   PDBe
Header : RNA
Title : NMR structure of 5'-R(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
Release Data : 2003-11-25
Compound :
mol_id molecule chains
1 18S ribosomal RNA, 5'ETS A
fragment: B2NRE
other_details: B2: a RNA hairpin derived from nts 394-410 of the mouse 5' ETS.
Source :
mol_id organism_scientific
1 Mus musculus  (taxid:10090)
synthetic: yes
other_details: THE RNA WAS CHEMICALLY SYNTHESIZED in vitro using T7 RNA polymerase and synthetic DNA templates. THE SEQUENCE OF THE RNA IS NATURALLY FOUND IN MUS MUSCULUS (mouse).
Authors : Finger, L.D., Trantirek, L., Johansson, C., Feigon, J.
Keywords : tetraloop, UNCG, UUCG, YNMG, bulged nucleotide, hairpin, A-form helix, RNA
Exp. method : SOLUTION NMR
Citation :

Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin

Finger, L.D.,Trantirek, L.,Johansson, C.  et al.
(2003)  Nucleic Acids Res.  31 : 6461 - 6472

PubMed: 14602904
DOI: 10.1093/nar/gkg866