PDB ID: 1QWA
The number of atoms exceeds 100,000. So, it can not be displayed here.
Select unit:
Select chain: Sequence
Data format:
Color scheme of protein:
| Code | Name | Style | Show | Link |
|---|
| Code | Name | Show |
|---|
| Code | Name | Emphasize |
|---|
| Code | Name | Show |
|---|
Download interaction data: 1QWA
Structure summary
| Code : | 1QWA PDBj RCSB PDB PDBe | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Header : | RNA | ||||||||||||
| Title : | NMR structure of 5'-R(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | ||||||||||||
| Release Data : | 2003-11-25 | ||||||||||||
| Compound : |
|
||||||||||||
| Source : |
|
||||||||||||
| Authors : | Finger, L.D., Trantirek, L., Johansson, C., Feigon, J. | ||||||||||||
| Keywords : | tetraloop, UNCG, UUCG, YNMG, bulged nucleotide, hairpin, A-form helix, RNA | ||||||||||||
| Exp. method : | SOLUTION NMR | ||||||||||||
| Citation : |
Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Finger, L.D.,Trantirek, L.,Johansson, C.
et al.
PubMed: 14602904 |
||||||||||||


