Brand  (β version)
from 4v8m  [Download
T

created by OpenBabel

Hetero-Atom Name Thymidine-5'-monophosphate
Synonym -
Code T
Formula C10 H15 N2 O8 P
Links PDB Ligand   PDBj   RCSB PDB   PDBe
Code 1PVP
TitleBASIS FOR A SWITCH IN SUBSTRATE SPECIFICITY: CRYSTAL STRUCTURE OF SELECTED VARIANT OF CRE SITE-SPECIFIC RECOMBINASE, ALSHG BOUND TO THE ENGINEERED RECOGNITION SITE LOXM7
SouceEnterobacteria phage P1, Synthetic
Code 1PVQ
TitleBASIS FOR A SWITCH IN SUBSTRATE SPECIFICITY: CRYSTAL STRUCTURE OF SELECTED VARIANT OF CRE SITE-SPECIFIC RECOMBINASE, LNSGG BOUND TO THE ENGINEERED RECOGNITION SITE LOXM7
SouceEnterobacteria phage P1, Synthetic
Code 1QWA
TitleNMR structure of 5'-R(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
SouceSynthetic
Code 4V8M
TitleHigh-resolution cryo-electron microscopy structure of the Trypanosoma brucei ribosome
SouceTRYPANOSOMA BRUCEI, TRYPANOSOMA BRUCEI BRUCEI