Brand  (β version)
from 1qwa  [Download mmcif  mol
T

created by OpenBabel

Hetero-Atom Name Thymidine-5'-monophosphate
Synonym -
Code T
Formula C10 H15 N2 O8 P
Links PDB Ligand   PDBj   RCSB PDB
Code 1PVP
TitleBASIS FOR A SWITCH IN SUBSTRATE SPECIFICITY: CRYSTAL STRUCTURE OF SELECTED VARIANT OF CRE SITE-SPECIFIC RECOMBINASE, ALSHG BOUND TO THE ENGINEERED RECOGNITION SITE LOXM7
SouceEnterobacteria phage P1, Synthetic
Code 1PVQ
TitleBASIS FOR A SWITCH IN SUBSTRATE SPECIFICITY: CRYSTAL STRUCTURE OF SELECTED VARIANT OF CRE SITE-SPECIFIC RECOMBINASE, LNSGG BOUND TO THE ENGINEERED RECOGNITION SITE LOXM7
SouceEnterobacteria phage P1, Synthetic
Code 1QWA
TitleNMR structure of 5'-R(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
SouceSynthetic