Brand  (β version)
from 1qwa  [Download

created by OpenBabel

Hetero-Atom Name Thymidine-5'-monophosphate
Synonym -
Code T
Formula C10 H15 N2 O8 P
Links PDB Ligand   PDBj   RCSB PDB   PDBe
Code 1PVP
SouceEnterobacteria phage P1, Synthetic
Code 1PVQ
SouceEnterobacteria phage P1, Synthetic
Code 1QWA
TitleNMR structure of 5'-R(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
Code 4V8M
TitleHigh-resolution cryo-electron microscopy structure of the Trypanosoma brucei ribosome